BACK TO ARCHIVE ......................................................2-15-04

The following Excerpt is taken from The God Code: The Secret of Our Past, the Promise of Our Future, (Hay House, Feb. 2004) by Gregg Braden. It is available at all bookstores or online at: www.hayhouse.com.

The God Code:
The Secret of Our Past, the Promise of Our Future
By Gregg Braden


Chapter Six:

The Code Within the Code: In Each Cell of Every Life, the Name of God


The Alphabet of DNA: Translated

Almost from the moment that the code of life was discovered, scientists and non-scientists alike have described the genetic blueprint of life as a "language." In a rare press conference held during the summer of 2000 regarding matters of science, then-President Bill Clinton stood beside the leaders of two companies that had completed one of the largest cooperative research efforts in history: the Human Genome Project. Through their combined efforts, they’d produced the first map of our genetic code and opened the door to a new era of medical and life sciences in the 21st century. In describing the significance of the milestone, Clinton declared that the genome was the "language in which God created life."34

As frequent as such references are, more often than not they are used only figuratively to describe the building blocks of life—the "language" of life’s chemical code. From the relationships described previously in this book, however, it is clear that DNA may now be regarded as the very real language of an ancient and translatable alphabet. It is that language that preserves the single message transcending any differences that could ever separate us as the family of humankind. To reveal the message in our bodies, we must understand the alphabet of life.

***

The genius of Watson and Crick’s discovery lay in their description of the DNA molecule itself. In very nontechnical terms, the building blocks of life are surprisingly simple, and they’re arranged in a way that is both remarkably efficient and, at the same time, pleasing to the eye. The essence of genetic research is based in the understanding that all life is formed as combinations of only four chemical compounds. These basic units of life—adenine, thymine, guanine, and cytosine (A, T, G, and C respectively)—called DNA bases, carry all of the information required to produce every form of life that is known to exist. From the smallest single-celled organisms to the estimated 100 trillion cells that make up a single human body, the code of each life form is made from different arrangements of these four bases.

Through a process that is only partially understood, the bases arrange themselves into precise pairs, known as base pairs, with each pair containing the patterns that combine with other pairs to produce the blueprints of life. In other words, each base only works with a specific partner: guanine always pairs with cytosine (G-C), and adenine always pairs with thymine (A-T). The pairs are arranged opposite one another, forming the rungs of a twisted, ladderlike structure, the familiar double helix35 (see Figure 6.4). These base pairs make up the gene-code notation that has become so familiar over the last few years.

On June 26, 2000, the world watched in awe as the announcement was made that two competing companies, one private and one federal, had pooled their resources to produce the first map of how the bases that form human DNA are arranged. In illustrating this map, seemingly endless streams of alphabetic letters were flashed upon our television screens and across the pages of popular magazines. The sequences, some of which were hundreds of letters long, represented the bases that had been identified at different places on the human DNA molecule. These combinations are known as genes. It is groups of genes that form the 23 pairs of living information (chromosomes) that make us unique as a species.36 Following is a portion of human chromosome 1 to illustrate the appearance of this code:

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG

Two hundred and forty bases from a portion of human chromosome 1.

The key to translating the code of DNA into a meaningful language is to apply the discovery that converts elements to letters. Based upon their matching values, hydrogen becomes the Hebrew letter Yod (Y), nitrogen becomes the letter Hey (H), oxygen becomes the letter Vav (V), and carbon ©) becomes Gimel (G). These substitutions now reveal that the ancient form of God’s name, YH, exists as the literal chemistry of our genetic code (shaded letters Figure 6.5). Through this bridge between God’s name and the elements of modern science, it now becomes possible to reveal the full mystery and find even greater meaning in the ancient code that lives as each cell of our bodies.

In Each Cell of Every Life: The Code Revealed


During an interview, Albert Einstein was once asked to describe his understanding of what God is like. In his reply, he alluded to the fact that, although the Creator is not seen directly, we are shown evidence of His existence in each moment of every day.

"My comprehension of God," Einstein shared, "comes from the deeply felt conviction of a superior intelligence that reveals itself in the knowable world."37 Through such candid insights, we’re given a glimpse into the way one of the greatest minds of the last century perceived the intelligence underlying our world. The discovery linking that intelligence to the elements of life now gives even greater meaning to Einstein’s perception.

When we substitute modern elements for all four letters of God’s ancient name, we see a result that, at first blush, may be unexpected. Replacing the final H in YHVH with its chemical equivalent of nitrogen, God’s name becomes the elements hydrogen, nitrogen, oxygen, and nitrogen (HNON)—all colorless, odorless, and invisible gases! In other words, replacing 100 percent of God’s personal name with the elements of this world creates a substance that is an intangible, yet very real form of creation!

Indeed, in the earliest descriptions of God, we are told that He is omnipresent and takes on a form in our world that cannot be seen with our eyes. Thus, He can be known only through His manifestations. The Sepher Yetzirah describes this nonphysical form of God’s presence as the "Breath" of God.

"Ten Sefirot of Nothingness: One is the Breath of the Living God, Life of worlds. . . .
This is the Holy Breath."
38

Additionally, the first chapters of Genesis relate that it is in a nonphysical form that the Creator was present during the time of creation (Genesis 1:2). It was "the spirit of God" [author’s emphasis] that first moved over the face of the earth.

The Sepher Yetzirah further describes the first Hebrew letter to emerge from the void of creation as the Mother Letter that made the universe possible: Alef. Through a great, mystical "secret," Alef then evolved into the first element to appear in our universe, hydrogen, as well as the first letter of God’s name: Yod. Modern theories of the Big Bang now suggest that hydrogen was the first element to form from the energy released at the instant of creation, and remains as the single most abundant element in the universe. Both accounts appear to be describing the same element!

Exodus reminds us in very specific terms that the name YHVH was revealed as the personal name of God. In equally clear terms, we are shown that humankind is made "in the image" of God. Perhaps in these statements may be found the most direct clue describing our relationship to the source of all that "is." With a new emphasis, the statement regarding our origins reminds us that we are made only in the image of God, rather than being made as, or equal to, God. Although subtle, this statement suggests that, while we undeniably share in the attributes of our Creator, we’re also set apart from YHVH by something that makes us very different.

Substituting modern elements for the ancient letters, it is clear that although we share in the first three letters representing 75 percent of our Creator’s name, it is the fourth and final letter of our chemical name sets us apart from God’s (see Figure 6.6). While the presence of God is the invisible and intangible form of the three gases hydrogen, nitrogen, and oxygen, the last letter of our name is the "stuff" that gives us the color, taste, texture, and sounds of our body: carbon. The one letter that sets us apart from God is also the element that makes us "real" in our world.

This is not to suggest that God is simply a wispy gas made of invisible elements. Rather, it’s through the very name that God divulged to Moses over three millennia ago that our world and the foundation of life itself became possible. God tells us that in the form of hydrogen, the single most abundant element of the universe, He is a part of all that has ever been, is, and will be.

The Name of God in the Body of Man

Legend states that when King Solomon built his holy temple in Jerusalem, an ancient ritual took place, preceding even the laying of the first stone. Preserved through the traditions of the Masons today, that ritual involved the orientation and laying of one stone, the cornerstone, to which all other stones of the massive complex would eventually be oriented. It is told that the king placed one sheet of parchment within this cornerstone upon which he himself had inscribed a single name. Symbolically, the name anchoring the cornerstone of Jerusalem’s Holy Temple would also become the name upon which King Solomon would base the leadership of his people, the power of his nation, and become the basis for one third of the earth’s organized religions. That single name was the tetragrammaton YHVH, the timeless name of God.

An even closer examination of the actual letters that form the name of God and the body of man clarifies precisely what this ancient relationship says to us today. While original versions of the biblical texts fully acknowledge God’s name as YHVH, they also refer to the shortened version as YH, as was previously noted. Scholars generally accept the two names YHVH and YH as interchangeable.39 When translated, the name YH may be read as "the Eternal."40

Although the specifics may vary across time and culture, in modern English the meaning of the word eternal clearly implies an existence having no beginning or end and functioning beyond the limitations of time.41 It is precisely this "eternal" aspect that’s common to both the name of God, YHVH, and the human body, YHVG, as indicated by the shaded letters. Through both the secret letter codes of antiquity, and the literal translation of DNA as an alphabet, we’re shown that something about our existence remains lasting and eternal. We share that never-ending quality with our Creator through a full 5 percent of the elements that define our genetic code.

YHVH = the name of God
YHVG = the name of Man

YH (God/Eternal) forms one-half of God’s name and the name coded into our cells.